95
|
Addgene inc
murine plko 1 shgfp control Murine Plko 1 Shgfp Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/murine plko 1 shgfp control/product/Addgene inc Average 95 stars, based on 1 article reviews
murine plko 1 shgfp control - by Bioz Stars,
2026-02
95/100 stars
|
Buy from Supplier |
90
|
Addgene inc
shrna control plko.1-shgfp cat#30323 Shrna Control Plko.1 Shgfp Cat#30323, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna control plko.1-shgfp cat#30323/product/Addgene inc Average 90 stars, based on 1 article reviews
shrna control plko.1-shgfp cat#30323 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
virapower kit Virapower Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/virapower kit/product/Thermo Fisher Average 86 stars, based on 1 article reviews
virapower kit - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
93
|
Addgene inc
target sequence plko shcon caacaagatgaagagcaccaa plko shgfp tacaacagccacaacgtctat plko shgli1 gctcagcttgtgtgtaattat plko shyap1 Target Sequence Plko Shcon Caacaagatgaagagcaccaa Plko Shgfp Tacaacagccacaacgtctat Plko Shgli1 Gctcagcttgtgtgtaattat Plko Shyap1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/target sequence plko shcon caacaagatgaagagcaccaa plko shgfp tacaacagccacaacgtctat plko shgli1 gctcagcttgtgtgtaattat plko shyap1/product/Addgene inc Average 93 stars, based on 1 article reviews
target sequence plko shcon caacaagatgaagagcaccaa plko shgfp tacaacagccacaacgtctat plko shgli1 gctcagcttgtgtgtaattat plko shyap1 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |