murine plko 1 shgfp control Search Results


95
Addgene inc murine plko 1 shgfp control
Murine Plko 1 Shgfp Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/murine plko 1 shgfp control/product/Addgene inc
Average 95 stars, based on 1 article reviews
murine plko 1 shgfp control - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

90
Addgene inc shrna control plko.1-shgfp cat#30323
Shrna Control Plko.1 Shgfp Cat#30323, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna control plko.1-shgfp cat#30323/product/Addgene inc
Average 90 stars, based on 1 article reviews
shrna control plko.1-shgfp cat#30323 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

86
Thermo Fisher virapower kit
Virapower Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/virapower kit/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
virapower kit - by Bioz Stars, 2026-02
86/100 stars
  Buy from Supplier

93
Addgene inc target sequence plko shcon caacaagatgaagagcaccaa plko shgfp tacaacagccacaacgtctat plko shgli1 gctcagcttgtgtgtaattat plko shyap1
Target Sequence Plko Shcon Caacaagatgaagagcaccaa Plko Shgfp Tacaacagccacaacgtctat Plko Shgli1 Gctcagcttgtgtgtaattat Plko Shyap1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/target sequence plko shcon caacaagatgaagagcaccaa plko shgfp tacaacagccacaacgtctat plko shgli1 gctcagcttgtgtgtaattat plko shyap1/product/Addgene inc
Average 93 stars, based on 1 article reviews
target sequence plko shcon caacaagatgaagagcaccaa plko shgfp tacaacagccacaacgtctat plko shgli1 gctcagcttgtgtgtaattat plko shyap1 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results